In this model of part of the telomerase enzyme, green highlights the groove that “anchors” it near the chromosome's tip.

Telomeres, the long chains of DNA letters capping the ends of chromosomes, seem like a Dr. Seuss creation. What they spell out, in the language of DNA, amounts to gibberish.

The exact spelling varies from organism to organism but usually consists of repetitions of a single 6- to 10-letter “word.” In human telomeres, the sequence is TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG… stretching for thousands of letters.

For all their senseless monotony, telomeres play essential roles in cells and organisms. Without them, the genetic legacy of higher organisms could not endure as it does through countless generations (see sidebar). But that same life sustenance that telomeres breathe into species can also bring death to individual organisms, explains HHMI president Thomas R. Cech, whose laboratory at the University of Colorado studies telomerase, the enzyme that maintains telomeres on chromosomes. “Telomerase is involved in about 90 percent of cancers,” Cech says.

All human cells initially contain telomerase, he explains, but most adult body cells, which typically divide only a limited number of times, lack the enzyme. As those cells age, their telomeres gradually shorten, prompting them to stop growing and senesce. But telomerase becomes reactivated in cancer cells, continually lengthening the telomeres, endowing the cells with immortality and energy-sapping dominion over the body.

Cech's research team recently made a key finding about a crucial piece of the enzyme, called telomerase reverse transcriptase (TERT). Understanding TERT's three-dimensional structure could help scientists develop drugs to turn the renegade enzyme off in cancer cells. But until very recently, attempts to grow crystals of the enzyme, required for solving its structure, had failed. “Lots of labs have been trying to crystallize it since we discovered TERT 9 years ago, but the protein has never been very soluble,” Cech says. When produced in bacteria, the enzyme molecules tend to aggregate into misshapen clumps, called inclusion bodies, which are useless for structural studies.

Image: Courtesy of Steven Jacobs/Cech lab

	PAGE 1 OF 2	Continue